Step 1: Upload Files Help News

Genome File Requirements

• Files must be in standard FASTA format.
• File names should end with a '.fasta' or '.fa', extension.
• Genome files can only contain DNA sequences.
• There is currently a maximum limit of 10 genome files.
• Genome files are currently limited to having between 1 and 10 contig/supercontig sequences.
• ID lines should only contain your contig/supercontig names- we recommend only using letters, numbers, periods and dashes.
• ID lines should not end with a space character.
• ID lines may not contain the following reserved characters: | { } [ ] ( )
• By default, contigs are processed in order first-to-last and accordingly drawn from left-to-right.
• Individual files must not exceed 100MB in size.

Gene File Requirements

• Files must be in standard FASTA format.
• File names should end with a '.fasta' or '.fa', extension.
• Gene files may contain DNA or standard protein sequences.
• There is currently a maximum limit of 10 gene files.
• Each gene file is currently limited to contain a maximum of 60 gene sequences.
• ID lines may not end with a space character.
• ID lines may not contain the following reserved characters: | { } [ ] ( )
• Identical gene names appearing in the same file will have numbers appended (e.g. MyGene.1, MyGene.2, MyGene.3 etc.) and treated as separate genes.
• When using multiple gene files, gene names without identical spelling will be treated as separate genes (e.g. MyGene1 ≠ MyGene ≠ My-Gene).
• Individual files must not exceed 100MB in size.

Minimum Query Coverage Cutoff

Only query sequences with a percentage of basepairs/residues falling within significant BLAST hits at, or above, this value will appear in your results. Using the full-length gene query sequence, we tile the hits or 'HSPs' (High-scoring Segment Pair) which map with the same strand/direction as the HSP with the highest bitscore. A simplified example is shown below:

Original Query Gene: 1 ACCACCTTGAACAATCC 17
Genome Contig Sequence: 1 AACACCTCTCTCTTAAACTTT 21

BLAST HIT 1:
Query 1 ACCACCT 7
        | |||||
Sbjct 1 AACACCT 7

BLAST HIT 2:
Query 6  CTTGAACAAT 15
         ||| |||  |
Sbjct 12 CTTAAACTTT 21

Now we map the significant hits back to the original:

Original: ACCACCTTGAACAATCC
    Hit1: A-CACCT
    Hit2:      CTT-AAC--T
Combined: ACCACCTTGAACAAT--
Coverage: 15/17 (88.24%)

Note how the gaps within BLAST hits are ignored when calculating the final coverage score. If the 'Minimum Query Coverage Cutoff' was set to 88% this gene would map, however, if it was set to 89% it would not. This feature is included to help avoid queries with only a small fragment mapping to a genome from cluttering up results. Setting the value to '1' will show any query with at least one significant hit in your results.

Circular Genome Mode

This mode can be useful when dealing with circular genomes from bacteria or mitochondria. When using this mode, Genome1 acts as a reference for the order that genes appear. All other genomes will then be rotated to maximize the number of genes which match this order. This mode requires each genome to have only one circular contig and will be disabled if you upload a genome with more than one contig.